Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.003671 |
Chromosome: | chromosome 12 |
Location: | 7655668 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555400 | CGLD32 | Conserved in the Green Lineage and Diatoms; (1 of 1) PF10693 - Protein of unknown function (DUF2499) (DUF2499) | outside_mRNA |
Cre12.g555450 | PMK,IPK,IMPK | (1 of 1) 2.7.1.140 - Inositol-tetrakisphosphate 5-kinase / 1D-myo-inositol-tetrakisphosphate 5-kinase; inositol-tetrakisphosphate 5-kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGCAGTGTCGTAGCTCGGAACTACTGATGAAGTGATCGTGATCGGTG |
Internal bar code: | ACTACTGGGGAAATATTAGAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3612 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTGTCCGGTACACAGTGA |
Suggested primer 2: | TGCAACTCCCTGGACAATCC |