| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.003699 |
| Chromosome: | chromosome 7 |
| Location: | 2193420 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327100 | (1 of 12) IPR000326 - Phosphatidic acid phosphatase type 2/haloperoxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGGCAGCAGCAGGAGCAGGGGGAGCAGGGGCAGGGGCAGGGACAACG |
| Internal bar code: | GTGTCCGCATGGCAACTGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1311 |
| LEAP-Seq percent confirming: | 82.8571 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGGAGCAGGTTGGAATG |
| Suggested primer 2: | GTCAAACTGGGGAGTGGAGG |