Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.003753 |
Chromosome: | chromosome 16 |
Location: | 3102064 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g664750 | (1 of 1) IPR000225//IPR016024//IPR021133 - Armadillo // Armadillo-type fold // HEAT, type 2 | 3'UTR | |
Cre16.g664801 | RBL4 | rhomboid-like protease; (1 of 4) PTHR22936//PTHR22936:SF32 - RHOMBOID-RELATED // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTGTTGAATCGCGTGGCTTGCTTGGGCACTCCCCAGCACAACGACAA |
Internal bar code: | TTAAGTAGTCGTTGGGTGCATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2286 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGACAAACACACCGTTGC |
Suggested primer 2: | TGACGCCACATTACCACCAG |