| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.003865 |
| Chromosome: | chromosome 6 |
| Location: | 7720448 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302650 | RRM5 | (1 of 2) 2.1.1.166 - 23S rRNA (uridine(2552)-2'-O)-methyltransferase / Um2552 methyltransferase; Putative ribosomal RNA methyltransferase | 3'UTR |
| Cre06.g302700 | (1 of 1) PF00560//PF13516 - Leucine Rich Repeat (LRR_1) // Leucine Rich repeat (LRR_6) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAGAGATGTGGGGACGTGGCACGCATGCCGGGAAAAGTGTCGGTCGTC |
| Internal bar code: | TTAGGTTTGCCGTGAGGTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1132 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACCCTGCAGCTTTCCAC |
| Suggested primer 2: | GGAGCATACGTACTCCGGTG |