Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.003920 |
Chromosome: | chromosome 16 |
Location: | 5209573 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684600 | SEC5 | (1 of 1) K17637 - exocyst complex component 2 (EXOC2, SEC5); Component of the Exocyst Complex | 3'UTR |
Cre16.g684650 | (1 of 2) PTHR13748//PTHR13748:SF45 - COBW-RELATED // SUBFAMILY NOT NAMED; Putative metallochaperone | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTACGCCCAACCCAGGCGCCAAACCAACATGGGACAACGTCGGCCCCG |
Internal bar code: | TTGACGGCTTCAAATCCATCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1245 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAAACGTGCGCTGCTTCAC |
Suggested primer 2: | GCAGCATTGGCAAGTGTTGA |