Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.003947 |
Chromosome: | chromosome 6 |
Location: | 8259727 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g306800 | CGL126 | protein tyrosine kinase; (1 of 1) K08851 - TP53 regulating kinase and related kinases [EC:2.7.11.1] (TP53RK, PRPK, BUD32) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCATTCTGCTACCGCAGTGCGTGGACGAAAGGCGGTGTCACAACCCG |
Internal bar code: | CTGTACGAAGGGAGGTGACGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 637 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGGCACACAATCAAAGGC |
Suggested primer 2: | GCTGCTCTCGGATGCAAATG |