Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.004012 |
Chromosome: | chromosome 16 |
Location: | 1165856 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650400 | CPL20 | Hypothetical zinc-dependent DNA-binding protein; (1 of 1) IPR000104//IPR006734 - Antifreeze protein, type I // Protein of unknown function DUF597 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACATCACCTTTGCGCTGTTGATAATGTAGTTCTGCGAGGTTTGCGTTGG |
Internal bar code: | CGTAAGCGTGAATCCAGAATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2955 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCGACGCGTTCCCTAACAA |
Suggested primer 2: | GCAGGAGTGGTCACATGTCA |