Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.004027 |
Chromosome: | chromosome 8 |
Location: | 3534647 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379200 | CPLD18 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR33471//PTHR33471:SF5 - FAMILY NOT NAMED // EXPRESSED PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAATCATGACAGTACGCGCCAACCCTGGCGGCTGCACAGGGTGTGTGG |
Internal bar code: | ATGCACGTAATACGGGTCGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4871 |
LEAP-Seq percent confirming: | 96.0 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTTAAGGCCGCATGTACG |
Suggested primer 2: | AGCGCCAAAACGAACTTTCC |