| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.004048 |
| Chromosome: | chromosome 12 |
| Location: | 2878436 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502900 | (1 of 3) 3.4.24.13 - IgA-specific metalloendopeptidase / Immunoglobulin A1 proteinase | outside_mRNA | |
| Cre12.g502950 | CPL15 | RNA-binding S4 domain-containing protein; (1 of 1) IPR002942//IPR017506 - RNA-binding S4 domain // Photosystem II S4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCCATAAATATGTCTCAGCGCCTAGGCGCGCGCGCGGCCATGCTCTG |
| Internal bar code: | CACTCCTTTTATTGCTCAAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4826 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 82 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCGCGGACAAAGATTGGA |
| Suggested primer 2: | GCCGCACCACCATTCTTTTT |