Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.004077 |
Chromosome: | chromosome 3 |
Location: | 5726005 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g187050 | PHT4-3,PHT3,PHT4C | (1 of 1) K12303 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 9 (SLC17A9); Na+-dependent inorganic phosphate cotransporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAAGAGGGGGCTGGGGAGAGTGTGATTGACCTGTTGTGGTATAAGGA |
Internal bar code: | ACATGCAGCCGTGTTGAACTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 600 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCGACTAGCAGCACAGAGC |
Suggested primer 2: | GGCATGACGTTTGCAACACT |