| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.004140 |
| Chromosome: | chromosome 4 |
| Location: | 3120095 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225800 | CPLD71 | dihydrolipoyllysine-residue acetyltransferase; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTGCACCAGCTGCTGCTGCACTGCGGGCCGCTGCTGCCGCACCCCAG |
| Internal bar code: | CTTTCTCAGGAGATACATGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4541 |
| LEAP-Seq percent confirming: | 55.3846 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGAAGTCGCGGTTGACA |
| Suggested primer 2: | GTTTGGAGGTGTTGCTGCAG |