| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004170 |
| Chromosome: | chromosome 8 |
| Location: | 3153256 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376300 | LIL5, SEP2 | Stress Enhanced Protein 2; (1 of 45) IPR023329 - Chlorophyll a/b binding protein domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCATACAGGTAATCCACGGCGCGGTCCACCTGGTGAGGCAAAGCGTT |
| Internal bar code: | CAGCAGTCGGCTACAGCTACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4700 |
| LEAP-Seq percent confirming: | 99.0385 |
| LEAP-Seq n confirming: | 103 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 104 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAGGGTAGCAACTTGGCA |
| Suggested primer 2: | CAGAGCAATTGATGTCGGCG |