| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.004203 |
| Chromosome: | chromosome 12 |
| Location: | 2815979 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g503550 | MEC1,MCS,MECPS1 | 2-C-methyl-D-erythritol 2%252C4-cyclodiphosphate synthase; (1 of 1) 4.6.1.12 - 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase / MECDP-synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAACGTTGCCCCTGACGTGTGTGTCGCAGGAGAACATCCGCAACAAC |
| Internal bar code: | TGTTGTACTTAGGGGTAGGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1035 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCTATGACTGAAACGCG |
| Suggested primer 2: | ACGCCAGGATTCATGGGTTT |