| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004211 |
| Chromosome: | chromosome 17 |
| Location: | 3448327 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g723550 | IPP4,CPLD4 | (1 of 1) 3.1.3.15 - Histidinol-phosphatase; Putative Inositol-phosphate phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTCAGTCGCCCATACCATAGAAGCACCAGGTAGGCGCTTTACGACTG |
| Internal bar code: | GTGCGCCACGGTTATGCTGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 725 |
| LEAP-Seq percent confirming: | 31.9149 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGAGGACAAGAGCGTGGA |
| Suggested primer 2: | GCTCGCTGCATGTCTCAATG |