| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004237 |
| Chromosome: | chromosome 16 |
| Location: | 6106896 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677450 | (1 of 2) 5.1.3.15 - Glucose-6-phosphate 1-epimerase | 3'UTR | |
| Cre16.g801985 | (1 of 1) K10740 - replication factor A3 (RPA3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGCGTGCTGCGCCCGGCTGTCGTCAGATTTACGTGCTGAACATGCCG |
| Internal bar code: | GGGGTTGGAACAACTTGCCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3019 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGCGGCATAGATTGTTTG |
| Suggested primer 2: | GGAACCCTCACCTGACCATG |