| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004312 |
| Chromosome: | chromosome 3 |
| Location: | 4195343 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g173450 | PAO4 | Pheophorbide a oxygenase-related protein; (1 of 8) 1.14.12.20 - Pheophorbide a oxygenase / Pheide a oxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAGCACCCACCTCCGACAGCGGCGCCAGGCGGTGTGGGCACATGTCC |
| Internal bar code: | GCACCCGGTGACGGATTAGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2155 |
| LEAP-Seq percent confirming: | 89.7436 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCACCCACATCCTCAAT |
| Suggested primer 2: | TACGGGAAGAGGGAAGGGAG |