Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.004356 |
Chromosome: | chromosome 11 |
Location: | 322109 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467569 | ATPD,ATPD1 | Chloroplast ATP synthase delta chain; (1 of 1) K02113 - F-type H+-transporting ATPase subunit delta (ATPF1D, atpH) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTGCGCCGGGGACTCTTTCGACAATTGCCTTTTACTTTCGGCATCAT |
Internal bar code: | AGCGTGCGATCGAGTGTAGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1960 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGATGCGTGAAGAATGCTG |
Suggested primer 2: | TCTTGTCCGACTCCACAACG |