| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.004378 |
| Chromosome: | chromosome 7 |
| Location: | 828937 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318350 | CGL64 | (1 of 4) PF12576 - Protein of unknown function (DUF3754) (DUF3754); Conserved in the Green Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCCTCCCTTACCCCCCTTCTTCTGTGCTGTCTGTTGTTCTTTGCAAC |
| Internal bar code: | GTAGCAATGCGTGATGCGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 747 |
| LEAP-Seq percent confirming: | 90.4762 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCACATTCCCAACCCC |
| Suggested primer 2: | GCCCAGAAGGACTTGAGCAT |