| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.004406 |
| Chromosome: | chromosome 12 |
| Location: | 1443790 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488350 | (1 of 2) K00464 - all-trans-8'-apo-beta-carotenal 15,15'-oxygenase (diox1) | 3'UTR | |
| Cre12.g488351 | (1 of 1) IPR001368//IPR009030//IPR011641 - TNFR/NGFR cysteine-rich region // Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGTCCGGACCTGCATCCACCGCATCCGCGCCTCAGTGCCCTTCAGCA |
| Internal bar code: | TAGTTCATACGTTCAATTTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 529 |
| LEAP-Seq percent confirming: | 48.1481 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGAGAGCCCATGTTTGT |
| Suggested primer 2: | TTGGGGCTGTGATAAGCAGG |