Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.004454 |
Chromosome: | chromosome 16 |
Location: | 5819354 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679950 | RFC3 | DNA replication factor C complex subunit 3; (1 of 1) PTHR11669:SF1 - REPLICATION FACTOR C SUBUNIT 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCCCAGCCGCCGCGCCCCACAAGCCCAGCGCCACGCCCTACTGTAAC |
Internal bar code: | CACTCTCACAATCGTTTCTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCATACCTGCTCTCTGCT |
Suggested primer 2: | AACGAGTTGAGGGACGTCAC |