Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.004460 |
Chromosome: | chromosome 16 |
Location: | 1405106 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g652200 | MMP9 | Metalloproteinase of VMP family; (1 of 51) PF05548 - Gametolysin peptidase M11 (Peptidase_M11) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGAGCCACAGACAGGCGGTACGGCACTCACGATGGTGACGTACTGTCC |
Internal bar code: | CACACATTACCGTGTGGGCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3333 |
LEAP-Seq percent confirming: | 88.1481 |
LEAP-Seq n confirming: | 119 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 135 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCACGCCAGTAGCTATGG |
Suggested primer 2: | GAGCTGTACCCCATATCGGC |