| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004514 |
| Chromosome: | chromosome 16 |
| Location: | 3904266 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689150 | SQD3,GTR23 | Sulfoquinovosyldiacylglycerol synthase; (1 of 2) K06119 - sulfoquinovosyltransferase (SQD2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACCGACGCCTGTATGTCGCCGCCCGCGCAGGTTCGCCTGGCTGGCCAA |
| Internal bar code: | GGGTAAGCGACCCTTGTAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4257 |
| LEAP-Seq percent confirming: | 98.0769 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACGGGTCGTCAACAACAC |
| Suggested primer 2: | TTTGATTGGTGGCATTGCGG |