| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.004526 |
| Chromosome: | chromosome 4 |
| Location: | 3093644 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225600 | CGL104 | mitochondrial glycoprotein family protein; (1 of 1) PTHR10826:SF1 - COMPLEMENT COMPONENT 1 Q SUBCOMPONENT-BINDING PROTEIN, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTTGACAGCCTCAGCATTTCGGGGCTGCTTTAGGCTGCTTTAGGATG |
| Internal bar code: | GCCCACGGGCGGGCAAGGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1033 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTCAACCGTGTGAAACC |
| Suggested primer 2: | CGGCGAGTACCTTACCATCC |