| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004553 |
| Chromosome: | chromosome 10 |
| Location: | 2340144 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434600 | TRP21,FAP148 | (1 of 1) PTHR22847//PTHR22847:SF493 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED; Cation Channel Domain Flagellar Associated Protein 148 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATCGTGGGCCACCAGAACGGCCCCTGCCGCTGCGTCAAACTCAGCGCC |
| Internal bar code: | GGCAGTTAGAAATTTGCCAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1317 |
| LEAP-Seq percent confirming: | 11.7647 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGAAGGAGCAGTAGAGCG |
| Suggested primer 2: | TGTTCAACCAGGAGACCAGC |