Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.004574 |
Chromosome: | chromosome 2 |
Location: | 1114992 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g080700 | BIP1 | (1 of 2) K09490 - heat shock 70kDa protein 5 (HSPA5, BIP); Endoplasmic reticulum associated Hsp70 protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATCGACGCCCGCAACCAGCTGGAGACCTACTGCTACAACATGAAGAGC |
Internal bar code: | GCAGGTGCAGGTCGGTATAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2064 |
LEAP-Seq percent confirming: | 78.7234 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACATCCTACGAGTCGAGGC |
Suggested primer 2: | AGGACATCCTGCTCCTGGAT |