| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.004574 |
| Chromosome: | chromosome 2 |
| Location: | 7656627 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g147550 | (1 of 2) IPR009057//IPR017877 - Homeodomain-like // Myb-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCCTCACCCTCCCAGCCCTCCCCGTCGCCCCCATCGTCCACGTCCAT |
| Internal bar code: | TTTATGCTTATTGCATGTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1606 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCGGTAGGATGCGGAAG |
| Suggested primer 2: | ACATGATACGCTTAGCCGGG |