| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.004651 |
| Chromosome: | chromosome 5 |
| Location: | 2152080 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237050 | CGLD27 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR34214:SF3 - GB|AAC18972.1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCATAATCCATAGCACAGCTGCCCCGCCGCGTCACCCCGGCCCTGCAT |
| Internal bar code: | ATTAACTTCCAGTTCAGCAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1016 |
| LEAP-Seq percent confirming: | 54.5455 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTATGGCTGTGCGAAGGT |
| Suggested primer 2: | CGTAGATTGGCAGCGCTTTC |