| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.004681 |
| Chromosome: | chromosome 6 |
| Location: | 2902269 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g272850 | uL10m,MRPL10,PRPL10 | (1 of 1) K02864 - large subunit ribosomal protein L10 (RP-L10, MRPL10, rplJ); Mitochondrial/chloroplast ribosomal protein L10 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCCAGCCCTTATCCTACCAACAAACCTATCTCCTGTCAAACGAGCTC |
| Internal bar code: | AATTTGTAGGTGGTCGTCCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2158 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGACGACGACAAGACCAAG |
| Suggested primer 2: | GGCTGGTGCTGGAGTGTTAT |