| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004850 |
| Chromosome: | chromosome 3 |
| Location: | 4146235 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172850 | OASTL3,ASL3 | (1 of 3) 2.5.1.47 - Cysteine synthase / OAS sulfhydrylase; O-acetylserine (Thiol)-lyase/cysteine synthase 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGATGGTGGTGGTGGTGGTGGTGGGATGCGGCGTAGGGGTTGCAGTCG |
| Internal bar code: | AAGCACGTATTTGTTCCCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 109 |
| LEAP-Seq percent confirming: | 61.1111 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGACGGGATGTGTCAAC |
| Suggested primer 2: | ACCCCATACACACACACGTC |