| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004882 |
| Chromosome: | chromosome 5 |
| Location: | 3584758 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234100 | CYP745A1,CYP17 | Cytochrome P450, CYP197 superfamily; (1 of 1) PTHR24305:SF59 - CYTOCHROME P450 313A1-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGTGCTGGGTTCGTTCATGTGAGGCCGAGGCAATGGCGAGAGGCCGCG |
| Internal bar code: | TAGCAAATTAACGTCTGGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2706 |
| LEAP-Seq percent confirming: | 89.3939 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGAGAGGCTGTACGAGTGA |
| Suggested primer 2: | CCTCCACCCCAATCACCTTC |