Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.004903 |
Chromosome: | chromosome 5 |
Location: | 166659 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g242600 | CGL106 | (1 of 2) IPR000679//IPR013088 - Zinc finger, GATA-type // Zinc finger, NHR/GATA-type; zinc finger GATA transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAACCCAAATGTCATCCGACCATTGACATCCACCCGCCCAGTGCTAGC |
Internal bar code: | AAGCTTTGCCTCCCTTCTTACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4518 |
LEAP-Seq percent confirming: | 92.4528 |
LEAP-Seq n confirming: | 98 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 106 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCCCACTTTGGAAACCA |
Suggested primer 2: | AAACAATTGGCGCACAGACC |