Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.004912 |
Chromosome: | chromosome 10 |
Location: | 1732171 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g430150 | REP27,LPA1 | (1 of 1) PF11998//PF13414 - Protein of unknown function (DUF3493) (DUF3493) // TPR repeat (TPR_11); Low Photosystem II Accumulation 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACGAGTGCCCCAGATCTCTCAGTCATTCATGTTTGTCAGGCAAGAAAA |
Internal bar code: | CGAAATACATACTACGATATTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2715 |
LEAP-Seq percent confirming: | 97.8261 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCAGAGATGGCTGTTGCAG |
Suggested primer 2: | GCACGGGAATGTTGCACTTT |