| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004979 |
| Chromosome: | chromosome 3 |
| Location: | 5850143 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188250 | AGP4,STA6 | ADP-glucose pyrophosphorylase small subunit; (1 of 1) PTHR22572//PTHR22572:SF79 - SUGAR-1-PHOSPHATE GUANYL TRANSFERASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCACGTGGGCAACGCACGGCTTGCACCGTCCGATGCATCGTCCCCTCC |
| Internal bar code: | AGTGACGCGAAACTTGGTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3770 |
| LEAP-Seq percent confirming: | 93.617 |
| LEAP-Seq n confirming: | 132 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 141 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGTAAAGTCACGCACGCT |
| Suggested primer 2: | GGGGGATTGAGTGTCCTTGG |