| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005035 |
| Chromosome: | chromosome 16 |
| Location: | 3216214 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665650 | HFLX1,HFLX | Putative chloroplast GTP-bidning protein involved in ribosome hibernation or ribosome biogenesis; (1 of 1) K03665 - GTP-binding protein HflX (hflX) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGCTCTCTCCCCACGCCCCAGGTGCGGCGCATCGCGGCCAAGCGCAC |
| Internal bar code: | TGCATGAAAACTTGTATGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3326 |
| LEAP-Seq percent confirming: | 76.6667 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTCAACAAAACACCGGCC |
| Suggested primer 2: | TCATCCTGCATGTGGTGGAC |