| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005099 |
| Chromosome: | chromosome 12 |
| Location: | 9203387 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g543050 | (1 of 1) PF04241 - Protein of unknown function (DUF423) (DUF423) | intron | |
| Cre12.g543100 | (1 of 1) K03256 - tRNA (adenine-N(1)-)-methyltransferase non-catalytic subunit (TRM6, GCD10) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGACGCTGTGCCAGGCAGCTCTGTAACGCAACCCATGGCCCGACGCTC |
| Internal bar code: | CTGGTTTATAATGTGAAGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5704 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 122 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 122 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCATGATACCGGTAC |
| Suggested primer 2: | GCTAGAAGCGTCGACCCTAC |