| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.005121 |
| Chromosome: | chromosome 7 |
| Location: | 2659869 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330650 | (1 of 10) PF02536 - mTERF (mTERF) | 3'UTR | |
| Cre07.g330700 | FAP91,Cam-IP2 | Flagellar Associated Protein 91; (1 of 1) PF14738 - Solute carrier (proton/amino acid symporter), TRAMD3 or PAT1 (PaaSYMP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATAAGCAACGAATCGTGCACGGCCGCACGTCACAAAACAGGACCCCA |
| Internal bar code: | AAAGGATCCGGTCACTGGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1054 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGATTGGCGATGGAGGCAT |
| Suggested primer 2: | CGTATGTCTGGGTGATCCGG |