Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.005129 |
Chromosome: | chromosome 15 |
Location: | 300270 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g635100 | (1 of 2) IPR000104//IPR010402 - Antifreeze protein, type I // CCT domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCGAGAGAGAGAGAGAGCGAGGTGCACGAAAAGCGAGTGAGGGAGGC |
Internal bar code: | TACATTAACGCAAGAGGTTACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2329 |
LEAP-Seq percent confirming: | 81.6901 |
LEAP-Seq n confirming: | 58 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAAAGCAACCTGAAGGGG |
Suggested primer 2: | CACACGCTCACTCACTCACT |