| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005159 |
| Chromosome: | chromosome 17 |
| Location: | 3041663 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720000 | CCT9 | (1 of 1) IPR002423//IPR027409 - Chaperonin Cpn60/TCP-1 family // GroEL-like apical domain; T-complex protein 1, eta subunit | CDS |
| Cre17.g720050 | FTSH2,FHL2 | (1 of 1) PTHR23076:SF72 - ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 2, CHLOROPLASTIC-RELATED; membrane AAA-metalloprotease, chloroplast | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGACCACATGCTCGACGTGCGCCAGCGACGCCAGCGACGCGCCCAGG |
| Internal bar code: | GGAGCTTGGCCCAGTTAGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2641 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTAAGCGTTGTTTGCTGGC |
| Suggested primer 2: | GTCGGCGTGCCAAAAAGATT |