| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005163 |
| Chromosome: | chromosome 1 |
| Location: | 2511598 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014800 | MSH7,CPL21 | putative MutS type 2 DNA repair protein; (1 of 1) K07456 - DNA mismatch repair protein MutS2 (mutS2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCACCTGCTTGATACGGCGGATGTGGCCACTAAAGGTGGACAGGTTCT |
| Internal bar code: | CGGGGTAGCGTCTCTCCCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3841 |
| LEAP-Seq percent confirming: | 89.7436 |
| LEAP-Seq n confirming: | 70 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGACGACCTTGCTGATT |
| Suggested primer 2: | GCACCCTAGAGGCAATTGGT |