Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.005175 |
Chromosome: | chromosome 6 |
Location: | 1459456 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260250 | CEMA,CEM1,YCF10 | putative proton extrusion protein cemA, chloroplastic; (1 of 1) PTHR33650:SF1 - CEMA-LIKE PROTON EXTRUSION PROTEIN-LIKE PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTTCCCACGCCACGCGAACCCCGACCGCCAGCCCCGCCGCCCAACCT |
Internal bar code: | AAATGTTACTTCATTAGCTTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5887 |
LEAP-Seq percent confirming: | 84.4156 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCCACGAAAAACACGCT |
Suggested primer 2: | CGGGAAGACCAACTTGACGA |