| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.005187 |
| Chromosome: | chromosome 1 |
| Location: | 6287995 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044650 | (1 of 1) PF00168//PF17047 - C2 domain (C2) // Synaptotagmin-like mitochondrial-lipid-binding domain (SMP_LBD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCTTTGCCGACCCCCGGAAACGACTGCCCCCGTAGGACATCACGGCC |
| Internal bar code: | GACTGCCCATTGAAAGCGGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3399 |
| LEAP-Seq percent confirming: | 97.8571 |
| LEAP-Seq n confirming: | 137 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 140 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCGCAGTTGCATGTTGAC |
| Suggested primer 2: | ACGGTTGTCGAGTAAACGCT |