| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005263 |
| Chromosome: | chromosome 6 |
| Location: | 6636428 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294750 | CHLG1,CHLG | Chlorophyll synthetase; (1 of 1) 2.5.1.62 - Chlorophyll synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTATTGTGGAACGGGCGGGAACTCCGTCATGGCGCTCCGCATCGAGCC |
| Internal bar code: | AAATTCCCACAGCGTGATTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4095 |
| LEAP-Seq percent confirming: | 80.8333 |
| LEAP-Seq n confirming: | 97 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 120 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCTCCAATTAAGCCCCC |
| Suggested primer 2: | GCCTGAAGTGAGAGCGAGTT |