| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.005271 |
| Chromosome: | chromosome 16 |
| Location: | 3222228 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665750 | MAA2,RAA2 | psaA mRNA trans-splicing factor; (1 of 3) 5.4.99.25 - tRNA pseudouridine(55) synthase / tRNA Psi(55) synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTTGATCCTGTCTTAGCGCCAGCCCTCTTACACCGTCCTGAGTGGTTC |
| Internal bar code: | ATCTGTGGCCCAGTGGTGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3784 |
| LEAP-Seq percent confirming: | 79.798 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATGGAGCACTGAGGCGAA |
| Suggested primer 2: | TTCCAAACAGGCGCACATTG |