Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.005281 |
Chromosome: | chromosome 7 |
Location: | 1134666 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g320750 | CYG12 | Adenylate/guanylate cyclase, nitric oxide sensing; (1 of 5) K12319 - guanylate cyclase soluble subunit beta (GUCY1B) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCCGAGTGCTTTGGTCCTTCGGGCGCCTCGTCACTGCGAGCGCCAGT |
Internal bar code: | GTTTCTCATCCCTATCTGAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1367 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCTTTAGATGCAGGCGT |
Suggested primer 2: | TCACTCACAACGCCCTGTAC |