| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005415 |
| Chromosome: | chromosome 2 |
| Location: | 3471605 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098950 | SYP72 | Qc-SNARE protein, SYP7-family; (1 of 2) K08506 - syntaxin of plants SYP7 (SYP7) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATCTACGCGGTGCCGGACGGCATGAGCATGGCGGGGGCCCGCAGGCC |
| Internal bar code: | CAACTGACATTGTGGCATTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2557 |
| LEAP-Seq percent confirming: | 65.8824 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCACGTTTGGAACAGAAC |
| Suggested primer 2: | GCTCTGCCCCTGACAAATCT |