| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.005496 |
| Chromosome: | chromosome 6 |
| Location: | 7820498 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g303300 | CYN37 | (1 of 1) PTHR11071:SF174 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE CYP37, CHLOROPLASTIC; Cyclophilin 37 | 3'UTR |
| Cre06.g303350 | FAL9 | Conserved protein of unknown function | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTCACTGCCGGACTGGCTTTATAATTACACTTCACAGTCACCGAGTC |
| Internal bar code: | GGTGAAGTTTGGGGCGGGCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2130 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 128 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 128 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAGTCTAGCCGCAACTC |
| Suggested primer 2: | AGCCAGGAGGGTCGTAATCT |