| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.005591 |
| Chromosome: | chromosome 17 |
| Location: | 662931 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g700300 | CGL22 | cdc48-like protein; (1 of 3) PF00004//PF07724 - ATPase family associated with various cellular activities (AAA) (AAA) // AAA domain (Cdc48 subfamily) (AAA_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTCTACCTCCGCATCCTCCTGCACCTTACCTTGCCCGTAGCCGAGG |
| Internal bar code: | GGGATACCCTGACACCAGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1106 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTGTTGAGTGTGCCACA |
| Suggested primer 2: | ATGGAATTGAAGAGGCCGCA |