| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005604 |
| Chromosome: | plastome |
| Location: | 59307 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802287 | ChreCp023,atpE,2716972 | ATP synthase epsilon chain; (1 of 1) K02114 - F-type H+-transporting ATPase subunit epsilon (ATPF1E, atpC) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAAGGACGCTCTGGTGTTAAAATAGAAATTTGTAAACTCATAATAAAAA |
| Internal bar code: | CGCTAGTTCAGGAGTCGCCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 135 |
| LEAP-Seq percent confirming: | 15.3846 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCTTTAAGCGCGGTAACT |
| Suggested primer 2: | ACAACAACAAGAGGACCAGCA |