| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.005629 |
| Chromosome: | chromosome 16 |
| Location: | 7851361 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689087 | RTN1 | (1 of 1) PTHR10994//PTHR10994:SF71 - RETICULON // RETICULON-LIKE PROTEIN B3; related to reticulon | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGACTTGCCCTGTGGGTCCGCCGCGCTGCCCGTCCCGCAGGTGGACT |
| Internal bar code: | AATAGTGGGTAATTCTCCTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGAGGTGGCATTCATGAA |
| Suggested primer 2: | CACGATGCTCGCTTGACATG |