| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005705 |
| Chromosome: | chromosome 8 |
| Location: | 224496 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358557 | (1 of 2) PF10173 - Mitochondrial K+-H+ exchange-related (Mit_KHE1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCCCGTGCCCGTGCCCGTGCCCCCGCTCGCGCTCCCTCGCCCGCTCC |
| Internal bar code: | TTATACTACCGAGTTCGTGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 389 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGTGACTGGAGTCCAAG |
| Suggested primer 2: | GGAACAAAACGGGGAAACGG |